View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_high_21 (Length: 320)
Name: NF0669_high_21
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 292
Target Start/End: Original strand, 34952641 - 34952923
Alignment:
| Q |
9 |
gaagaatatagtagcaaattcaccaaaatgaaataacattagccttttgtcattgccatatcaaaacaccaaccaaattaatctttattgtcaaccaatt |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34952641 |
gaagaaaatagtagcaaattcaccaaaatgaaataacattagccttttgtcactgccatatcaaaacaccaaccaaattaatctttatcgtcaaccaatt |
34952740 |
T |
 |
| Q |
109 |
ttccccattttaaaacctatttcgtgaactagtgatgagttttataataaatgtaaggacaaaacgaaattgagacacaaaattaaaacttcaagatctc |
208 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34952741 |
ttcccctttttaaaatctatttcgtgaactagtgatgagtttcataacaaatgtaacgacaaaacgaaattgagacacgaaattaaaacttcaagatctc |
34952840 |
T |
 |
| Q |
209 |
atgcaaacaagatcacatttagattttgaaaaggaaaaataaaatgcataaacaagcttcaaactagaactttagtgtgtatat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34952841 |
atgcaaacaagatcacatttagattttgaaaaggaaaaataaaatgcataaacgagcttcaaact-gaactttagtgtgtatat |
34952923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University