View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0669_high_43 (Length: 227)

Name: NF0669_high_43
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0669_high_43
NF0669_high_43
[»] chr4 (1 HSPs)
chr4 (1-168)||(7854158-7854325)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 7854158 - 7854325
Alignment:
1 aatggccctactaatagtactgttcgaaaaatacttttctttctctcaaaattcatcattcctttgacttagagttagagggagataacttacactcaat 100  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||    
7854158 aatggccctactaatagtactgttctaaaaatacttttctttctctcaaaattggtcattcctttgacttagagttagagggagataacttacactcaat 7854257  T
101 atttttcagcgagatttaaaaagtgattgatttgatttaaaaagtgacagtgtgttgctgaaaaatat 168  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
7854258 atttttcagcgagatttaaaaagtgattgatttgaattaaaaagtgacagtgtgttgctgaaaaatat 7854325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3415 times since January 2019
Visitors: 4035