View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_high_44 (Length: 220)
Name: NF0669_high_44
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0669_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 36618743 - 36618571
Alignment:
Q |
1 |
aagcatcttccgaattcatccaaatgctcgaagccgaagtcgaacccaatcacatcactctcatcactctcctctctgcttgtgcccactctccctccaa |
100 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36618743 |
aagcagcttccgaattcatccaaatgctcgaagccgaagtcgaacccaatcacatcaccctcatcactctcctctctgcttgtgcccactctccctccaa |
36618644 |
T |
 |
Q |
101 |
aaccagcatcacctttggagctgcattacacacacacgctttcaaacatggctttgccatgaatgatgtgatg |
173 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36618643 |
aaccagcatcacctttggagctgcattacacacacacgctttcaaacatggctttgccatgaatgatgtgatg |
36618571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 36652496 - 36652324
Alignment:
Q |
1 |
aagcatcttccgaattcatccaaatgctcgaagccgaagtcgaacccaatcacatcactctcatcactctcctctctgcttgtgcccactctccctccaa |
100 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36652496 |
aagcagcttccgaattcatccaaatgctcgaagccgaagtcgaacccaatcacatcaccctcatcactctcctctctgcttgtgcccactctccctccaa |
36652397 |
T |
 |
Q |
101 |
aaccagcatcacctttggagctgcattacacacacacgctttcaaacatggctttgccatgaatgatgtgatg |
173 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36652396 |
aaccagcatcacctttggagctgcattacacacacacgctttcaaacatggctttgccatgaatgatgtgatg |
36652324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3313 times since January 2019
Visitors: 4031