View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_107 (Length: 228)
Name: NF0669_low_107
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_107 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 45666964 - 45666824
Alignment:
| Q |
1 |
cagctaatttatccattgttgagcaacaaatcnnnnnnnttctggcagccactggtgttgatgtcccgagcctcgcaataggtttgcaaattcacnnnnn |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45666964 |
cagctaatttatccattgtcgagcaacaaatcaaaaaaattctggcagccactggggttgatgtcccgagcctcgcaataggtttgcaaattcacttttt |
45666865 |
T |
|
| Q |
101 |
nnggttctgtgaatattaattgaactcgatagttagagatg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45666864 |
ttggttctgtgaatattaattgaactcgatagttagagatg |
45666824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 228
Target Start/End: Complemental strand, 45666678 - 45666650
Alignment:
| Q |
200 |
tcttttgacctgtaatttttgggtgatga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45666678 |
tcttttgacctgtaatttttgggtgatga |
45666650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3162 times since January 2019
Visitors: 4029