View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_109 (Length: 227)
Name: NF0669_low_109
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_109 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 7854158 - 7854325
Alignment:
| Q |
1 |
aatggccctactaatagtactgttcgaaaaatacttttctttctctcaaaattcatcattcctttgacttagagttagagggagataacttacactcaat |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7854158 |
aatggccctactaatagtactgttctaaaaatacttttctttctctcaaaattggtcattcctttgacttagagttagagggagataacttacactcaat |
7854257 |
T |
|
| Q |
101 |
atttttcagcgagatttaaaaagtgattgatttgatttaaaaagtgacagtgtgttgctgaaaaatat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7854258 |
atttttcagcgagatttaaaaagtgattgatttgaattaaaaagtgacagtgtgttgctgaaaaatat |
7854325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3233 times since January 2019
Visitors: 4030