View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_112 (Length: 212)
Name: NF0669_low_112
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0669_low_112 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 52831953 - 52832001
Alignment:
Q |
1 |
aagcatggcatctttaactttctctcttcgttctaagctaataggatca |
49 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52831953 |
aagcatggcatctttaactttctctcttcgttctaagctaataggatca |
52832001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 73 - 115
Target Start/End: Original strand, 52832025 - 52832067
Alignment:
Q |
73 |
atccgcaacagaaacacccttgttgattttttcatcaatttca |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52832025 |
atccgcaacagaaacacccttgttgattttttcatcaatttca |
52832067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University