View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0669_low_112 (Length: 212)

Name: NF0669_low_112
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0669_low_112
NF0669_low_112
[»] chr4 (2 HSPs)
chr4 (1-49)||(52831953-52832001)
chr4 (73-115)||(52832025-52832067)


Alignment Details
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 52831953 - 52832001
Alignment:
1 aagcatggcatctttaactttctctcttcgttctaagctaataggatca 49  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
52831953 aagcatggcatctttaactttctctcttcgttctaagctaataggatca 52832001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 73 - 115
Target Start/End: Original strand, 52832025 - 52832067
Alignment:
73 atccgcaacagaaacacccttgttgattttttcatcaatttca 115  Q
    |||||||||||||||||||||||||||||||||||||||||||    
52832025 atccgcaacagaaacacccttgttgattttttcatcaatttca 52832067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University