View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_113 (Length: 209)
Name: NF0669_low_113
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_113 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 24759976 - 24760049
Alignment:
| Q |
1 |
tggccaaccaattggtttccgatttccctatttttactgattcaattatttaatcagctttctctttcttcgat |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24759976 |
tggccaaccaattggtttccgatttccctatttttactgattcaattatttaatcagctttctctttcttcgat |
24760049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 52127411 - 52127484
Alignment:
| Q |
1 |
tggccaaccaattggtttccgatttccctatttttactgattcaattatttaatcagctttctctttcttcgat |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52127411 |
tggccaaccaattggtttccgatttccctatttttactgattcaattatttaatcagctttctctttcttcgat |
52127484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 11 - 70
Target Start/End: Original strand, 40163424 - 40163483
Alignment:
| Q |
11 |
attggtttccgatttccctatttttactgattcaattatttaatcagctttctctttctt |
70 |
Q |
| |
|
||||||||| |||||| || |||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
40163424 |
attggtttctgatttctctcatttttctgattcaatcatttaatcatctttctctttctt |
40163483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University