View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_25 (Length: 411)
Name: NF0669_low_25
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 1e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 287 - 389
Target Start/End: Original strand, 39540208 - 39540310
Alignment:
| Q |
287 |
tacttgttttcaacgttttaccctttgtcagcctattcgtgttttttcaagaaataatgttttgtgacattaagcattttccaaaatatatcctaatgat |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39540208 |
tacttgttttcaacgttttaccctttgtcagcctattcgtgttttttcaagaaataatgttttgcgacattaagcattttccaaaatatatcctaatgat |
39540307 |
T |
 |
| Q |
387 |
gat |
389 |
Q |
| |
|
||| |
|
|
| T |
39540308 |
gat |
39540310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 80 - 166
Target Start/End: Complemental strand, 437718 - 437632
Alignment:
| Q |
80 |
caatgcaatttagtaggaaggaaaatacatatcatccttaaaccgaatcaaactcagagactcggcgcgctccgactcggcacaaac |
166 |
Q |
| |
|
||||||||||||| ||||||||||||| || |||||||| |||||| | |||||| ||||||| || || ||||||||| ||||||| |
|
|
| T |
437718 |
caatgcaatttaggaggaaggaaaatagatctcatccttgaaccgagtgaaactcggagactcagcacgttccgactcgacacaaac |
437632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University