View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_37 (Length: 367)
Name: NF0669_low_37
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 8 - 347
Target Start/End: Original strand, 50530151 - 50530490
Alignment:
| Q |
8 |
gagcacagaaaccggcaatggcgtaagatagaacaacggaagggccagcgtgaacacgggtagcgtggccagtggtgacgaagactccggcgccgaccat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530151 |
gagcacagaaaccggcaatggcgtaagatagaacaacggaagggccagcgtgaacacgggtagcgtggccagtggtgacgaagactccggcgccgaccat |
50530250 |
T |
 |
| Q |
108 |
tccaccgataccaaagctgactaagtcaaaccaacggagggttttgcgcatgctgttaccggacctagctcgaacgcggctcatttcttcgtaagaagtg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50530251 |
tccaccgataccaaagctgactaagtcaaaccaacggaggcttttgcgcatgctgttgccggacctagctcgaacacggctcatttcttcgtaagaagtg |
50530350 |
T |
 |
| Q |
208 |
gagacggagaagccgcgacgagcaaagcgagagggagttttagcgacggcttggagatagtttgggaggctcgaaaacgatgagccatggcttgtcattg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530351 |
gagacggagaagccgcgacgagcaaagcgagagggagttttagcgacggcttggagatagtttgggaggctcgaaaacgatgagccatggcttgtcattg |
50530450 |
T |
 |
| Q |
308 |
cgtgcgctctttggttttgtttttctgtgtgtgatgatgt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530451 |
cgtgcgctctttggttttgtttttctgtgtgtgatgatgt |
50530490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University