View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_48 (Length: 324)
Name: NF0669_low_48
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0669_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 311
Target Start/End: Original strand, 22061533 - 22061829
Alignment:
Q |
19 |
ggacatcatcatcatccccagaaatacaatcttcaccagcgatctccatctctgatcagtttatcagcaaaacctccaattcatgctcctgttactcctc |
118 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22061533 |
ggacatcatcatcatccccggaaatacaatcttcaccagcgatctccatctctgatcagtttatcagcaaaacctccaattcatgctcctgttactcctc |
22061632 |
T |
 |
Q |
119 |
cactccgataatccttccttcttcgcttcaacacctaaatccggccaattgtttctgacgataataccaaaggttcactcgccggcgatggatttcggtg |
218 |
Q |
|
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22061633 |
cactccgatattccttccttcttcgctccaacacctaaatccggccaattgtttctgacgataataccaaaggttcactcgccggcgatggatttcggtg |
22061732 |
T |
 |
Q |
219 |
ttggattgtcggcgaacccta----ttaattatatccaaaatggtgctaacatctttgacaaaatcatcatcccttagatgtaactgattactattc |
311 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
22061733 |
ttggattgtcggcgaaccctattcgttaattatatccaaaatggtgttaacatctttgacaaaatgatcatcccttagatgtaactgattactattc |
22061829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 242 - 311
Target Start/End: Complemental strand, 32904337 - 32904268
Alignment:
Q |
242 |
aattatatccaaaatggtgctaacatctttgacaaaatcatcatcccttagatgtaactgattactattc |
311 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||| |||||||| |
|
|
T |
32904337 |
aattatatccaaaatggtcttaacatctttgacaaaaccatcatcccttaaatgtaactgactactattc |
32904268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2933 times since January 2019
Visitors: 4019