View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_49 (Length: 323)
Name: NF0669_low_49
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 7e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 94 - 249
Target Start/End: Complemental strand, 51912907 - 51912752
Alignment:
| Q |
94 |
acatcatcaaagttaacaatacttccttctcaattattactaattaccggttatttccaaatgtcttattccaaacgttattgagcttgaatgaccacta |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51912907 |
acatcatcaaagttaacaatacttccttctcaattattactaattaccggttatttccaaatgtcttattccaaacgttattgagcttgaatgaccacta |
51912808 |
T |
 |
| Q |
194 |
attggtgtaccgaatgaagagtcatttcccgtgtgtcctgcctgtgctctgtgctc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51912807 |
attggtgtaccgaatgaagagtcatttcccgtgtgtcctgcctgtgctctgtgctc |
51912752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University