View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_52 (Length: 320)
Name: NF0669_low_52
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_52 |
 |  |
|
| [»] chr2 (8 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 7e-40; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 233 - 320
Target Start/End: Complemental strand, 39825885 - 39825798
Alignment:
| Q |
233 |
gagtaactgttcccttgatcaaatgttgacgatgcatcctcaattgcaagagttgtggttacgacaacataaaaaacaattatgttgt |
320 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39825885 |
gagtaactgttcccgtgatcaaatgttgacgatgcatcctcaattgcaagagttgtggttacgacaacataaaaaacaattatgttgt |
39825798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 99 - 153
Target Start/End: Complemental strand, 39922179 - 39922125
Alignment:
| Q |
99 |
ggatttacatggggtgtcatcatggatccctgccatatagatttaatgcaaaaga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39922179 |
ggatttacatggggtgtcatcatggatccctgccatatagatttaatgcaaaaga |
39922125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 99 - 153
Target Start/End: Complemental strand, 39826017 - 39825963
Alignment:
| Q |
99 |
ggatttacatggggtgtcatcatggatccctgccatatagatttaatgcaaaaga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39826017 |
ggatttacatggggtgtcatcatggatccctgccatatagattgaatgcaaaaga |
39825963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 99 - 153
Target Start/End: Complemental strand, 39902578 - 39902524
Alignment:
| Q |
99 |
ggatttacatggggtgtcatcatggatccctgccatatagatttaatgcaaaaga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
39902578 |
ggatttacatggggtgtcatcatggatccctgccatataaattgaatgcaaaaga |
39902524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 99 - 153
Target Start/End: Complemental strand, 39911036 - 39910982
Alignment:
| Q |
99 |
ggatttacatggggtgtcatcatggatccctgccatatagatttaatgcaaaaga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
39911036 |
ggatttacatggggtgtcatcatggatccctgccatataaattgaatgcaaaaga |
39910982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 99 - 153
Target Start/End: Complemental strand, 39927875 - 39927821
Alignment:
| Q |
99 |
ggatttacatggggtgtcatcatggatccctgccatatagatttaatgcaaaaga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
39927875 |
ggatttacatggggtgtcatcatggatccctgccatataaattgaatgcaaaaga |
39927821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 99 - 137
Target Start/End: Complemental strand, 39805653 - 39805615
Alignment:
| Q |
99 |
ggatttacatggggtgtcatcatggatccctgccatata |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39805653 |
ggatttacatggggtgtcatcatggatccctgccatata |
39805615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 99 - 141
Target Start/End: Complemental strand, 39814938 - 39814896
Alignment:
| Q |
99 |
ggatttacatggggtgtcatcatggatccctgccatatagatt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
39814938 |
ggatttacatggggtgtcatcatggatccctgtcacatagatt |
39814896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University