View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_57 (Length: 303)
Name: NF0669_low_57
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 97 - 216
Target Start/End: Complemental strand, 1977681 - 1977562
Alignment:
| Q |
97 |
gttttgtgcaaatctagtctcacagacaacctcttgcagatgagttttgtttttcctgtgttgatatctaactgaaacaacaggtgtgataatatgcagg |
196 |
Q |
| |
|
||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||| || |
|
|
| T |
1977681 |
gttttgtgcaaatctgatctcacagatagtctcttgcagatgagttttgtttttcctgtgtagatatctaactgaaacagcaggcgtgataatatgccgg |
1977582 |
T |
|
| Q |
197 |
cctagaatcagagaaattgg |
216 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1977581 |
cctagaatcagagaaattgg |
1977562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2957 times since January 2019
Visitors: 4020