View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_60 (Length: 302)
Name: NF0669_low_60
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 59 - 231
Target Start/End: Original strand, 43284798 - 43284970
Alignment:
| Q |
59 |
gagcacagatctttagtttgattaaaccttgggtgtgatgactgatgatatattttaataatttaatcgaacaagctcgatcacatgctagtgctttgtt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43284798 |
gagcacagatctttagtttgattaaaccttgggtgtgatgactgatgatatattttaataatttaatcgaacaagctcgatcacatgctagtgctttgtt |
43284897 |
T |
 |
| Q |
159 |
agggttctcacttgttttggcgcttgaatgaactctaaaatttatgttggtgcggtgaaaaggcagatgatgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43284898 |
agggttctcacttgttttggcgcttgaatgaactctaaaatttatgttggtgcggtgaaaaggcagttgatgt |
43284970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University