View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0669_low_67 (Length: 290)

Name: NF0669_low_67
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0669_low_67
NF0669_low_67
[»] chr7 (2 HSPs)
chr7 (157-244)||(42039844-42039931)
chr7 (53-116)||(42039160-42039223)


Alignment Details
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 157 - 244
Target Start/End: Original strand, 42039844 - 42039931
Alignment:
157 taaaggtaatacatgannnnnnnatgaagttttcattattttggttataccatagacaaatttgtcacatataatgttatattattgg 244  Q
    ||||||||||||||||       ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||    
42039844 taaaggtaatacatgatttttttatggagttttcattattttagttataccatagacaaatttgtcacatataatgttatattcttgg 42039931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 53 - 116
Target Start/End: Original strand, 42039160 - 42039223
Alignment:
53 aatatcagcacaaaaagcaacatctcgaaaagnnnnnnnggcttgagaaaatagcacataccga 116  Q
    ||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||    
42039160 aatatcagcacaaaaagcaacatctcgaaaagaaaaaaaggcttgagaaaatagcacataccga 42039223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University