View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_67 (Length: 290)
Name: NF0669_low_67
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0669_low_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 157 - 244
Target Start/End: Original strand, 42039844 - 42039931
Alignment:
Q |
157 |
taaaggtaatacatgannnnnnnatgaagttttcattattttggttataccatagacaaatttgtcacatataatgttatattattgg |
244 |
Q |
|
|
|||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
42039844 |
taaaggtaatacatgatttttttatggagttttcattattttagttataccatagacaaatttgtcacatataatgttatattcttgg |
42039931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 53 - 116
Target Start/End: Original strand, 42039160 - 42039223
Alignment:
Q |
53 |
aatatcagcacaaaaagcaacatctcgaaaagnnnnnnnggcttgagaaaatagcacataccga |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
42039160 |
aatatcagcacaaaaagcaacatctcgaaaagaaaaaaaggcttgagaaaatagcacataccga |
42039223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University