View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_75 (Length: 280)
Name: NF0669_low_75
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_75 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 51 - 238
Target Start/End: Original strand, 13253911 - 13254097
Alignment:
| Q |
51 |
acatcatcccatataatagaagtaggcattatcccaactttttagacatttccaggaagctaaagatgcttctctaagaagcggttgttttgcatcccca |
150 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13253911 |
acatcatcccatataacagaagtag-cattatcccaactttttagacatttccaggaagctaaagatgcttctctaagaagcagttgttttgcatcccca |
13254009 |
T |
|
| Q |
151 |
actaacaatccattaaacttggtcaaagtttataatgcatacatagggatagtggacatgtaacaacttggtcaatatttttcctttg |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
13254010 |
actaacaatccattaaacttggtcaatgtttataatgcatacatagggatagtggacatgtaacaactttgtcaatattttttctttg |
13254097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3570 times since January 2019
Visitors: 4037