View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_79 (Length: 273)
Name: NF0669_low_79
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_79 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 8 - 238
Target Start/End: Complemental strand, 1534261 - 1534031
Alignment:
| Q |
8 |
gagcacagagcatgatgtttgaggagacgaagcatcaatgaaaaagaggcattctaaaataagaaaatccaagttctagctagtttgacgaaggctgagc |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1534261 |
gagcacaaagcatgatgtttgaggagacgaagcatcaatgaaaaagaggcattctaaaataagaaaatccaagttctagctagtttgacgaaggctgagc |
1534162 |
T |
|
| Q |
108 |
atcgaaagcccccttgcaattggaaggctatgacaacagaacatacttgaaggatattggatatctgaattggttgcatgaatttaatactcgtttggat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1534161 |
atcgaaagcccccttgcaattggaaggctatgacaacagaacatacttgaaggatattggatatctgaattggttgcatgaatttaatactcgtttggat |
1534062 |
T |
|
| Q |
208 |
ttaggttttatgtttggttgatgatgtccat |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
1534061 |
ttaggttttatgtttggttgatgatggccat |
1534031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2903 times since January 2019
Visitors: 4018