View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_83 (Length: 266)
Name: NF0669_low_83
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0669_low_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 28 - 229
Target Start/End: Complemental strand, 41955110 - 41954915
Alignment:
Q |
28 |
gagaggttggatagcaaaagctcgaggggatgaacttcactacagaacccatctcttcatgtgaaccccatcaaaataataatatgtttgtaggtcctac |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41955110 |
gagaggttggatagcaaaagctcgaggggatgaacttcactacagaacccatctcttcatgtgaaccccatcaaaataataatatgtttgtaggtcctac |
41955011 |
T |
 |
Q |
128 |
ctcacatacacaacccatgactcaaacaaaaacaaacactatatatcggggatgcatcagtacttttctactcgagaaatcttacggaatgaattatttt |
227 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41955010 |
ctcacatacacaacccatgactcaaa------caaacactatatatcggggatgcatgagtacttttctactcgagaaatcttacggaatgaattatttt |
41954917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University