View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_85 (Length: 263)
Name: NF0669_low_85
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_85 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 33 - 238
Target Start/End: Original strand, 13080506 - 13080708
Alignment:
| Q |
33 |
acatcatcaaaatgacaaaattcaaatatttttaggcctcaaacttattatacttttgattcaactaatactcttataattttattaannnnnnnnnagc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13080506 |
acatcatcaaaatgacaaaattcaaatatttttaggcctcaaacttattatacttttgattcaactaatactcttataattttattaa-ttttttttagt |
13080604 |
T |
 |
| Q |
133 |
gctggtagtataaatttcctttactaattttattgtacttaca-ttattgactagnnnnnnnnnnnnnngtgcgttgttaataatgtagtgcaaatttaa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13080605 |
gctggtagtataaatttcctttactaattttattgaacttacatttattgactag---tttttttttttgtgcgttgttaataatgtagtgcaaatttaa |
13080701 |
T |
 |
| Q |
232 |
agtagta |
238 |
Q |
| |
|
||||||| |
|
|
| T |
13080702 |
agtagta |
13080708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University