View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_90 (Length: 253)
Name: NF0669_low_90
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_90 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 26529129 - 26528900
Alignment:
| Q |
1 |
aaggttttgtttgacgtgcacaaataaaatgatattgcaccatgcataaatgtgtttttcattgttatatcaacgagagtggatattgtgtcaaagaagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
26529129 |
aaggttttgtttgacgtgcacaaataaaatgatattgcaccatgcataaatgtttttttcatcgttatatcaatgagagtcgatattgtgtcaaagaagg |
26529030 |
T |
|
| Q |
101 |
gaaaagtcaagtt-----------------aaggttgggtggtggttttatcaaccaatcacaaactttcgcaatcccttcgggatgattttttcgcagt |
183 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26529029 |
gaaaagtcaagttcaactttttgtggcataaaggctgggtggtggttttatcaaccaatcacaaactttcgcaatcccttcgggatgattttttcgctgt |
26528930 |
T |
|
| Q |
184 |
gtttatcattttcctatatcaataggtttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26528929 |
gtttatcattttcctatatcaataggtttg |
26528900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 29213015 - 29213073
Alignment:
| Q |
1 |
aaggttttgtttgacgtgcacaaataaaatgatattgcaccatgcataaatgtgttttt |
59 |
Q |
| |
|
|||||||||| | | |||||||| ||||||||| |||||||||||| | |||||||||| |
|
|
| T |
29213015 |
aaggttttgtctaatgtgcacaactaaaatgatcttgcaccatgcacacatgtgttttt |
29213073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3091 times since January 2019
Visitors: 4027