View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_93 (Length: 251)
Name: NF0669_low_93
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0669_low_93 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 23 - 251
Target Start/End: Original strand, 11868734 - 11868965
Alignment:
Q |
23 |
atcatcagaatctataagtaaaaaagccgccaagctggaaaagctccgatgtcgccaa---atggcctccgcggctactatgtccgtctctaatctctca |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||| ||||| ||||||||||||| |
|
|
T |
11868734 |
atcatcagaatctataagtaaaaaagccgccaagctggaaaagctccgatgttgccaacaaatggcctccgcggctcctacgtccgcctctaatctctca |
11868833 |
T |
 |
Q |
120 |
gcagaccccttagccaccaattatggcgacatcccgttaaaggagctgcaatcgaagacaccggtccatcctgtcccccggacccaggtcaaagcacttg |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
11868834 |
gcagaccccttagccaccaattatggcgacatcccgttaaaggagctgcaatcgaagacaccggtccatcctgtcccccggacccaggtcgaagcacttg |
11868933 |
T |
 |
Q |
220 |
acgcttcaccggtgaataattcagttagaatt |
251 |
Q |
|
|
||| ||||| |||||||||||||||||||||| |
|
|
T |
11868934 |
acgattcactggtgaataattcagttagaatt |
11868965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University