View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_96 (Length: 251)
Name: NF0669_low_96
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0669_low_96 |
 |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0157 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 35219 - 34986
Alignment:
| Q |
1 |
tgttgcggctttgtttctctagcctttcaacactggtggcctgagtttttgtctttttgttgcgtggatgttgatatgagatttgttttctctcttggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35219 |
tgttgcggctttgtttctctagcctttcaacactaatggcctgagtttttgtctttttgttgcgtggaagttgatatgagatttgttttctctcttggtg |
35120 |
T |
 |
| Q |
101 |
aggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatgaatatgtcatgattcttgataccaaatccgtgttcgcatatggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35119 |
aggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatgaatatgtcatgattcttgataccaaattcgtgttcgcatatggt |
35020 |
T |
 |
| Q |
201 |
ctgttacgattttgagggatccttggctgtgttg |
234 |
Q |
| |
|
||||| | |||||||||||||||||| ||||||| |
|
|
| T |
35019 |
ctgttccaattttgagggatccttggatgtgttg |
34986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 12485258 - 12485491
Alignment:
| Q |
1 |
tgttgcggctttgtttctctagcctttcaacactggtggcctgagtttttgtctttttgttgcgtggatgttgatatgagatttgttttctctcttggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12485258 |
tgttgcggctttgtttctctagcctttcaacactaatggcctgagtttttgtctttttgttgcgtggaagttgatatgagatttgttttctctcttggtg |
12485357 |
T |
 |
| Q |
101 |
aggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatgaatatgtcatgattcttgataccaaatccgtgttcgcatatggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12485358 |
aggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatgaatatgtcatgattcttgataccaaattcgtgttcgcatatggt |
12485457 |
T |
 |
| Q |
201 |
ctgttacgattttgagggatccttggctgtgttg |
234 |
Q |
| |
|
||||| | |||||||||||||||||| ||||||| |
|
|
| T |
12485458 |
ctgttccaattttgagggatccttggatgtgttg |
12485491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 12469134 - 12469331
Alignment:
| Q |
1 |
tgttgcggctttgtttctctagcctttcaacactggtggcctgagtttttgtctttttgttgcgtggatgttgatatgagatttgttttctctcttggtg |
100 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||| |||||| ||||||||||| |||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
12469134 |
tgttgcggctttgtttcttgggttattcaacactgatggccttagttttcatctttttgttgtgtggttgttgataccagatatgttttctctcttggtg |
12469233 |
T |
 |
| Q |
101 |
aggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatgaatatgtcatgattcttgataccaaatccgtgttcgcatatg |
198 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||||| ||||||||||||||||||||||||||| |||| |||||||||||| |||||| ||||| |
|
|
| T |
12469234 |
aggttttgttttctcgcaacgtgggttgtgatggactggtcacgatggtggtgatgaatatgtcacgattggtgataccaaatcaatgttcgtatatg |
12469331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 12466491 - 12466687
Alignment:
| Q |
1 |
tgttgcggctttgtttctctagcctttcaacactggtggcctgagtttttgtctttttgttgcgtggatgttgatatgagatttgttttctctcttggtg |
100 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||| |||||| |||||| ||||||||||| |||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
12466491 |
tgttgcagctttgtttctctggttgttcaacactgatggccttagttttcatctttttgttgtgtggttgttgataccagatatgttttctctcttggtg |
12466590 |
T |
 |
| Q |
101 |
aggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatgaatatgtcatgattcttgataccaaatccgtgttcgcatatg |
198 |
Q |
| |
|
||||| ||||||||||||| ||| || ||||||||| |||||||||||||||||| |||||||| |||| |||||||||||| |||||| ||||| |
|
|
| T |
12466591 |
aggttttgttttctcgcaatgtgggttgtgatggactggtcacgatggtggtgatg-atatgtcacgattggtgataccaaatcaatgttcgtatatg |
12466687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 100 - 159
Target Start/End: Original strand, 47518421 - 47518480
Alignment:
| Q |
100 |
gaggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatgaat |
159 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
47518421 |
gaggttatgtttgctcgcaacataggtggtgatggatcagtcacaatggtggtgatgaat |
47518480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 80 - 150
Target Start/End: Original strand, 23054177 - 23054254
Alignment:
| Q |
80 |
gatttgttttctctcttggt-------gaggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtg |
150 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
23054177 |
gatttgttttctctcttggttgtggtggaggttatgtttgctcgcaacataggtggtgatggatcagtcacgatggtg |
23054254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 100 - 152
Target Start/End: Original strand, 27170059 - 27170111
Alignment:
| Q |
100 |
gaggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggt |
152 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
27170059 |
gaggttatgtttgctcgcaacgtaagtggtgatggatcggtcacgatggtggt |
27170111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 156
Target Start/End: Complemental strand, 18697085 - 18697029
Alignment:
| Q |
100 |
gaggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatg |
156 |
Q |
| |
|
|||||||||||| | |||||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
18697085 |
gaggttatgtttgcccgcaacataggtggtgatggatcagtcacgatggtggtgatg |
18697029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 156
Target Start/End: Original strand, 1551571 - 1551624
Alignment:
| Q |
103 |
gttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatg |
156 |
Q |
| |
|
||||||||| |||||||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
1551571 |
gttatgtttgctcgcaacataggtggtgatggatcagtcacgatggtggtgatg |
1551624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 80 - 156
Target Start/End: Original strand, 17281887 - 17281970
Alignment:
| Q |
80 |
gatttgttttctctcttggt-------gaggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatg |
156 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| | ||||||||||| ||||||| |||||||||||| |
|
|
| T |
17281887 |
gatttgttttctctcttggtagtggtggaggttatgtttgctcgcaacataggtggtgatggatcagtcacaatggtggtgatg |
17281970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 156
Target Start/End: Complemental strand, 10408977 - 10408921
Alignment:
| Q |
100 |
gaggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatg |
156 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||| | |||||||||||||||||| |
|
|
| T |
10408977 |
gaggttatgtttgctcgcaacataggtggtgatggaacggtcacgatggtggtgatg |
10408921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 156
Target Start/End: Complemental strand, 34118124 - 34118068
Alignment:
| Q |
100 |
gaggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatg |
156 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||| | |||||||||||||||||| |
|
|
| T |
34118124 |
gaggttatgtttgctcgcaacataggtggtgatggatcggtcacgatggtggtgatg |
34118068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 70 - 156
Target Start/End: Original strand, 11407917 - 11408011
Alignment:
| Q |
70 |
gttgatatgagatttgttttctctcttggtg--------aggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatg |
156 |
Q |
| |
|
|||||||| | |||||||||||||||||||| ||||||||||| |||||||| | |||||||||||| | | ||||| |||||||||| |
|
|
| T |
11407917 |
gttgatatcatatttgttttctctcttggtggtgggtggaggttatgtttgctcgcaacataagtggtgatggatcggccacgaaggtggtgatg |
11408011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 156
Target Start/End: Complemental strand, 21881619 - 21881563
Alignment:
| Q |
100 |
gaggttatgttttctcgcaacgtgagtggtgatggaccagtcacgatggtggtgatg |
156 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
21881619 |
gaggttatgtttgctcgcaacaaaggtggtgatggatcggtcacgatggtggtgatg |
21881563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University