View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_97 (Length: 250)
Name: NF0669_low_97
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0669_low_97 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 32 - 227
Target Start/End: Complemental strand, 29860650 - 29860455
Alignment:
Q |
32 |
catactcatctctggttttgctgcattgtctttattcttgtgttgggtttttacctcccagcgccccatcctatacaacattggtgatcttatagatgta |
131 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29860650 |
catactcatctctggttttgctgcattgtctttattcttgtgttgggcttttacctcccagcgccccatcctatacaacattggtgatcttatagatgta |
29860551 |
T |
 |
Q |
132 |
cgatagcaaatttccctttagcttgagcaatacctttttatcacataaaacacccaagacactcctccactttagccaccccgcttgaatatgatg |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
29860550 |
cgatagcaaatttccctttagcttgagcaatacctttttatcacataaaacacccaagaccctcctccactttagccaccccgcttgaatatgatg |
29860455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 200
Target Start/End: Complemental strand, 46989784 - 46989728
Alignment:
Q |
144 |
tccctttagcttgagcaatacctttttatcacataaaacacccaagacactcctcca |
200 |
Q |
|
|
||||||||||||||||| ||||||||||||||||| || |||||| | |||||||| |
|
|
T |
46989784 |
tccctttagcttgagcagtacctttttatcacatataatccccaaggcgctcctcca |
46989728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University