View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0669_low_99 (Length: 250)
Name: NF0669_low_99
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0669_low_99 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 159 - 247
Target Start/End: Complemental strand, 13649435 - 13649348
Alignment:
Q |
159 |
tcgaccaggaatcttggcttatcccctttgtgttaccaaatctttcgattttacaaagaatgatgtcgatcagaagtctctgctcctcc |
247 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||| |||||||||||| ||| |||| |
|
|
T |
13649435 |
tcgaccgggaatcttggcttatcccctttgtgttaccaaatcttt-gatttcacaaagaatggtgtcaatcagaagtctcagcttctcc |
13649348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3351 times since January 2019
Visitors: 4032