View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0669_low_99 (Length: 250)

Name: NF0669_low_99
Description: NF0669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0669_low_99
NF0669_low_99
[»] chr5 (1 HSPs)
chr5 (159-247)||(13649348-13649435)


Alignment Details
Target: chr5 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 159 - 247
Target Start/End: Complemental strand, 13649435 - 13649348
Alignment:
159 tcgaccaggaatcttggcttatcccctttgtgttaccaaatctttcgattttacaaagaatgatgtcgatcagaagtctctgctcctcc 247  Q
    |||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||| |||||||||||| ||| ||||    
13649435 tcgaccgggaatcttggcttatcccctttgtgttaccaaatcttt-gatttcacaaagaatggtgtcaatcagaagtctcagcttctcc 13649348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University