View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0670_high_6 (Length: 269)
Name: NF0670_high_6
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0670_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 20 - 162
Target Start/End: Original strand, 43638779 - 43638921
Alignment:
| Q |
20 |
tgtggtggcgtgaaattcgtgggatgatgttcaacaccaaattagttcttttgcaaattggttcaccaaaattcatcgattatttggaggaaacggtaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43638779 |
tgtggtggcgtgaaattcgtgggatgatgttcaacaccaaattagttcttttgcaaattggttcaccaaaattcatcgattatttggaggaaacggtaaa |
43638878 |
T |
|
| Q |
120 |
ccatagaggnnnnnnnnntcatctctaatatatttgagcataa |
162 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43638879 |
ccatagaggaaaaaaaaatcatctctaatatatttgagcataa |
43638921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3411 times since January 2019
Visitors: 4035