View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0670_low_15 (Length: 269)

Name: NF0670_low_15
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0670_low_15
NF0670_low_15
[»] chr1 (1 HSPs)
chr1 (20-162)||(43638779-43638921)


Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 20 - 162
Target Start/End: Original strand, 43638779 - 43638921
Alignment:
20 tgtggtggcgtgaaattcgtgggatgatgttcaacaccaaattagttcttttgcaaattggttcaccaaaattcatcgattatttggaggaaacggtaaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43638779 tgtggtggcgtgaaattcgtgggatgatgttcaacaccaaattagttcttttgcaaattggttcaccaaaattcatcgattatttggaggaaacggtaaa 43638878  T
120 ccatagaggnnnnnnnnntcatctctaatatatttgagcataa 162  Q
    |||||||||         |||||||||||||||||||||||||    
43638879 ccatagaggaaaaaaaaatcatctctaatatatttgagcataa 43638921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University