View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0670_low_17 (Length: 265)
Name: NF0670_low_17
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0670_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 21 - 262
Target Start/End: Original strand, 39289820 - 39290061
Alignment:
| Q |
21 |
acatcatcaggaacagcacaagttttgacacctaacaatcaagctaacactccccaattttcggagacattgaaatctgataccgtgaataatgacgatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39289820 |
acatcatcaggaacagcacaagttttgacacctaacaatcaagctaacactccccaattttcggagacattgaaatctgataccgtgaataatgacgatg |
39289919 |
T |
|
| Q |
121 |
tgattagacctgatgatgcagagcttggagaagcagatcaagatgagcataaatctgaagatccattggataaatttcttcctcctccacccaaagataa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39289920 |
tgattagacctgatgatgcagagcttggagaagcagatcaagatgagcataaatctgaagatccattggataaatttcttcctcctccacccaaagataa |
39290019 |
T |
|
| Q |
221 |
atgtttagaggagctacaagtaagtcctcttcaatggtttaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39290020 |
atgtttagaggagctacaagtaagtcctcttcaatggtttaa |
39290061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3101 times since January 2019
Visitors: 4028