View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0670_low_18 (Length: 264)
Name: NF0670_low_18
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0670_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 30 - 256
Target Start/End: Complemental strand, 47827333 - 47827108
Alignment:
Q |
30 |
atattatataattccaaattaaatgttaaaaagttcaggcttcatacgaatttatattgcttaaattttgcatgcatgcaactcatcatgtcaacatgta |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47827333 |
atattatataattccaaattaaatgttaaaaa-ttcaggcttcatacgaatttatattgcttaaattttgcatgcatgcaactcatcatgtcaacatgta |
47827235 |
T |
 |
Q |
130 |
caactaattaaatttatcttataagagagtatatatgtcttacatttttgaaagtaggtaagccgtgataatcctggaatagagcgagttctttaaagac |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47827234 |
caactaattaaatttatcttataagagagtatatatgtcttacatttttgaaagtaggtaagccgtgataatcctggaatagagcgagttctttaaagac |
47827135 |
T |
 |
Q |
230 |
ggatgccccatctaatttcttcatctc |
256 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
47827134 |
tgatgccccatctaatttcttcatctc |
47827108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University