View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0670_low_22 (Length: 251)
Name: NF0670_low_22
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0670_low_22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 39290394 - 39290149
Alignment:
| Q |
6 |
agaaacaaaggcaatataaaccactctaatgtgaaaattacagatttaaatccagattattggttactgaaacaagtcatttcaactagcaatgcacatt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39290394 |
agaaacaaaggcaatataaaccactctaatgtgaaaattacagatttaaatccagattattggttactgaaacaagtcatttcaactagcaatgcacatt |
39290295 |
T |
 |
| Q |
106 |
ataaaagtacctatctccatgaaatgcatagatgctgagcagcaaagaaaggtaataagataaaatnnnnnnnngttcaacccaaccctctaattgccaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39290294 |
ataaaagtacctatctccatgaaatgcatagatgctgagcagcaaagaaaggtaataagataaaataaaaaaaagttcaacccaaccctctaattgccaa |
39290195 |
T |
 |
| Q |
206 |
agtttcttttttatcaaattcattggcaataaagaagattgaatgc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39290194 |
agtttcttttttatcaaattcattggcaataaagaatattgaatgc |
39290149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University