View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0670_low_23 (Length: 251)
Name: NF0670_low_23
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0670_low_23 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 32 - 251
Target Start/End: Original strand, 5957499 - 5957718
Alignment:
Q |
32 |
aagcttccacaacagaaacacaatcccaaaccttaaaacgacgcaacnnnnnnnncaacacacctcaaaacgacacagcacaagaacaagaacatgaaca |
131 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
5957499 |
aagcttccacaacagaaacacaatcccaaaccttaaaacgacgcaacaaaaaaaacaacacacctcaaaacgacacaacacaagaacaagaacatgaaca |
5957598 |
T |
 |
Q |
132 |
agaatttgaagattacgacgacggaattgatttcccatacgatgacccaccgttaatatgctgtttcggagcagcacagagggagtttctacctacggtg |
231 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5957599 |
agaatttgaagattacgacgacggaattgatttcccatacgatgacccaccgttaatatgctgtttcggagcagcacagagggagtttctacctacggtg |
5957698 |
T |
 |
Q |
232 |
cgtgtgcacgagtttccaat |
251 |
Q |
|
|
|||||||| ||||||||||| |
|
|
T |
5957699 |
cgtgtgcaggagtttccaat |
5957718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University