View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0670_low_25 (Length: 239)
Name: NF0670_low_25
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0670_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 43791092 - 43790896
Alignment:
| Q |
18 |
cttccaaagtactaatatttccaatttcacgaggcagtgatccaacaaaggtgttgttgttgagtacaagatctgtgaggttctgaagcttgtctatggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43791092 |
cttccaaagtactaatatttccaatttcacgaggcagtgatccaacaaaggtgttgttgttgagtacaagatctgtgaggttctgaagcttgtctatggt |
43790993 |
T |
|
| Q |
118 |
agatggaatttcactttcaaagctatttccagaaagatccaactgttgtattgaggaacagctgagtaactccaatggaaattttccagatagaata |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43790992 |
agatggaatttcactttcaaagctatttccagaaagatccaactgttgtattgaggaacagctgagtaactccaatggaaattttccagatagaata |
43790896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2889 times since January 2019
Visitors: 4018