View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0670_low_26 (Length: 236)
Name: NF0670_low_26
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0670_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 10693381 - 10693222
Alignment:
| Q |
1 |
tgatttattgaagaatagttattgaaataagtaaatatttaattgtttgaaaaagcaattgaaaacaacttatgatatgtttttaacttattttcaggta |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||| |||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10693381 |
tgatttattgaagaatagttattgacataagtaattattgaattgtttgaaagagcatatgaaaacaacttatgatatgtttgtaacttattttcaggta |
10693282 |
T |
|
| Q |
101 |
atttctatagggtaacttatgaaaacaatttatagtttatagtttgtatgcaaacatttt |
160 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10693281 |
atctctatagggtaacttatgaaaacaatttatagtttatagtttgtatgcaaacatttt |
10693222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 185 - 226
Target Start/End: Complemental strand, 10693191 - 10693150
Alignment:
| Q |
185 |
gtaatagaaatagtttatacaagaaaatgatacgtacctatg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10693191 |
gtaatagaaatagtttatacaagaaaatgatacgtacctatg |
10693150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2878 times since January 2019
Visitors: 4017