View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0670_low_6 (Length: 373)
Name: NF0670_low_6
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0670_low_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 97 - 373
Target Start/End: Complemental strand, 48677097 - 48676821
Alignment:
| Q |
97 |
attgctcctgtatggtctcagttagtcacatcttgaactaaagacccaacaaatgttagcacagtaggactccccaccagcctgtgactttctttctctc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48677097 |
attgctcctgtatggtctcagttagtcacatcttgaactaaagacccaacaaatgttagcacagtagtactccccaccagcctgtgactttctttctctc |
48676998 |
T |
|
| Q |
197 |
atttcacactaaaaacataacaaaacaccaacaattgaaatgccatgtcccatttgtgtcattctcattggtgtgtagctaaccctctataagtgattta |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48676997 |
atttcacactaaaaacataacaaaacaccaacaattgaaatgccatgtcccatttgtgtcattctcattggtgtgtagctaaccctctataagtgattga |
48676898 |
T |
|
| Q |
297 |
aatttcatcttgccaatttatctaggacccatttatatagctacaagctgtatatcagttcactagactaattctac |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48676897 |
aatttcatcttgccaatttatctaggacccatttatatagctacaagctgtatatcagttcactagactaattctac |
48676821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3219 times since January 2019
Visitors: 4030