View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0670_low_7 (Length: 364)
Name: NF0670_low_7
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0670_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 99 - 285
Target Start/End: Original strand, 3125396 - 3125582
Alignment:
Q |
99 |
aagaaatggagaccctcttccacgaaacccgagtgactacaagccgagataacagacaaaaatgttgtatcatttggtataacggcttctttctgcatat |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3125396 |
aagaaatggagaccctcttccacgaaacccgagtgactacaagccgagataacagacaaaaatgttgtatcatttggtataacggcttctttctgcatat |
3125495 |
T |
 |
Q |
199 |
tttcaaagatatcaatagcttcttttccaaggccatgtgtgccatatccatctatcatcgcattccatgttatcacatgtcgttcat |
285 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3125496 |
tgtcaaagatatcaatagcttcttttccaaggccatgtgtgccatatccatctatcatcgcattccatgttatcacatgtcgttcat |
3125582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 107 - 280
Target Start/End: Complemental strand, 3129774 - 3129598
Alignment:
Q |
107 |
gagaccctcttccacgaaacccgagtgactacaagccgagataacagacaaaaatgttgtatcatttggtataac---ggcttctttctgcatattttca |
203 |
Q |
|
|
||||||||||||||| ||||| |||||||||||||| || |||||||||| ||||||| ||||||||||| ||| |||||| |||||||||| ||| |
|
|
T |
3129774 |
gagaccctcttccacaaaacctgagtgactacaagcagaaataacagacagaaatgttatatcatttggtttaagagaggcttcgttctgcatatcatca |
3129675 |
T |
 |
Q |
204 |
aagatatcaatagcttcttttccaaggccatgtgtgccatatccatctatcatcgcattccatgttatcacatgtcg |
280 |
Q |
|
|
|||| ||| | |||| ||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||| |
|
|
T |
3129674 |
aagagatctagagctgcttttccaaggccatgtgttccatatccatcgatcattgcattccacgttatcacatgtcg |
3129598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University