View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0670_low_8 (Length: 356)
Name: NF0670_low_8
Description: NF0670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0670_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 25 - 262
Target Start/End: Complemental strand, 33454627 - 33454382
Alignment:
Q |
25 |
catcacaccaattttccttaaccataccggtttttccctcccttatataaccctcttcctacctcttctctaaccaagctccattcaac--------aca |
116 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
33454627 |
catcacaccaattttccttaaccataccggtttttccctcccttatataaccctcttcctacctcttctctaaccaagctccattcaactcttcaacaca |
33454528 |
T |
 |
Q |
117 |
tagcagtaacagaaaaagaagcaaaacattccaagaatttaacaatggcaaccaacgaagatcaaaagcaaactgaatctggaagacaccaagaagttgg |
216 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
33454527 |
tagcagaaacagaaaaagaagcaaaacattccaagaatttaacaatggcaaccaacgaagatcaaaatcaaactgaatctggaagacaccaagaagttgg |
33454428 |
T |
 |
Q |
217 |
tcacaagagtcttctacaaagtgatgctctttaccaggtacactca |
262 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33454427 |
tcacaagagtcttctacaaagtgatgctctttaccaggtacactca |
33454382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2549 times since January 2019
Visitors: 4010