View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_high_12 (Length: 315)
Name: NF0671_high_12
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0671_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 43567908 - 43567691
Alignment:
Q |
1 |
gaatgtgggaaaaaatactgcaaaaaataaagttagcagggtacatgggaaatactagtgaggcattgtttgacatagatgaggaggaaaaagaagatgc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43567908 |
gaatgtgggaaaaaatactgcaaaaaataaagttagcagggtacatgggaaatactagtgaggcattgtttgacatagatgaggaggaaaaagaagatgc |
43567809 |
T |
 |
Q |
101 |
acttcacaggcatggtgagaaactggccatttcctatggaattatgaagattcaagctcctgggcctattcggattgtgaaaaacttgcgtgtctgtgaa |
200 |
Q |
|
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
43567808 |
acttcacaggcatagtgagaaactggccattgcctatggaattatgaagattcaagctcctgggactattcggattgtgaaaaacttgcgtgtctgtgaa |
43567709 |
T |
 |
Q |
201 |
gattgtcacacagctacc |
218 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
43567708 |
gattgtcacacagctacc |
43567691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 172 - 208
Target Start/End: Original strand, 2447183 - 2447219
Alignment:
Q |
172 |
ggattgtgaaaaacttgcgtgtctgtgaagattgtca |
208 |
Q |
|
|
|||||||||| |||||||||||||| ||||||||||| |
|
|
T |
2447183 |
ggattgtgaagaacttgcgtgtctgcgaagattgtca |
2447219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University