View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0671_high_16 (Length: 267)

Name: NF0671_high_16
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0671_high_16
NF0671_high_16
[»] chr1 (1 HSPs)
chr1 (1-235)||(28330336-28330570)


Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 28330336 - 28330570
Alignment:
1 aaatcaaaaaaggtaagccctgacctcattacatataacactattattcatggcatgtgtaatttttcgaggatggactgtgcttgggattttattggtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28330336 aaatcaaaaaaggtaagccctgacctcattacatataacactattattcatggcatgtgtaatttttcgaggatggactgtgcttgggattttattggtg 28330435  T
101 agatggttgataagggcatacagcccgatgcagcaacctacaatccattactgaaggccctctgtagagagnnnnnnnttgatgaagctattgctttaac 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
28330436 agatggttgataagggcatacagcccgatgcagcaacctacaatccattactgaaggccctctgtagagagaaaaaaattgatgaagctattgctttaac 28330535  T
201 aaatagaatcagtggccagggcatccagctagatg 235  Q
    |||||||||||||||||||||||||||||||||||    
28330536 aaatagaatcagtggccagggcatccagctagatg 28330570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University