View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_high_16 (Length: 267)
Name: NF0671_high_16
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0671_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 28330336 - 28330570
Alignment:
Q |
1 |
aaatcaaaaaaggtaagccctgacctcattacatataacactattattcatggcatgtgtaatttttcgaggatggactgtgcttgggattttattggtg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28330336 |
aaatcaaaaaaggtaagccctgacctcattacatataacactattattcatggcatgtgtaatttttcgaggatggactgtgcttgggattttattggtg |
28330435 |
T |
 |
Q |
101 |
agatggttgataagggcatacagcccgatgcagcaacctacaatccattactgaaggccctctgtagagagnnnnnnnttgatgaagctattgctttaac |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
28330436 |
agatggttgataagggcatacagcccgatgcagcaacctacaatccattactgaaggccctctgtagagagaaaaaaattgatgaagctattgctttaac |
28330535 |
T |
 |
Q |
201 |
aaatagaatcagtggccagggcatccagctagatg |
235 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
28330536 |
aaatagaatcagtggccagggcatccagctagatg |
28330570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University