View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_high_20 (Length: 259)
Name: NF0671_high_20
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0671_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 12423909 - 12423677
Alignment:
Q |
1 |
caccacgaaggacgaaggtcaccccaaaagggagcaggacctatcgttgtataaacttatgggattacaactcgttgaggcactacaccaagtgattaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12423909 |
caccacgaaggacgaaggtcaccccaaaagggagcaggacctatcgttgtataaacttatgggattacaactcgttgaggcactacaccaagtgattaaa |
12423810 |
T |
 |
Q |
101 |
catgtacaaaaccaatctctcaataatagcacgggagtattggttgtatctcaagatccctgtccggttggctgtggctgaaaaatgtgtgttttttcat |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
12423809 |
catgtacaaaaccaatctctcaataatagcacgggagtattggttgtatctcaagatccctgtccggttggttgtggctgaagaatgtgtgttttttcat |
12423710 |
T |
 |
Q |
201 |
gttctttgttagttgtttgtgacaaggaacatg |
233 |
Q |
|
|
||||| ||||||||||||||||||||||||||| |
|
|
T |
12423709 |
gttctctgttagttgtttgtgacaaggaacatg |
12423677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 209
Target Start/End: Complemental strand, 23702020 - 23701951
Alignment:
Q |
140 |
ttggttgtatctcaagatccctgtccggttggctgtggctgaaaaatgtgtgttttttcatgttctttgt |
209 |
Q |
|
|
||||||||||||| |||||| ||||||| ||| || || |||| |||||||||||||||||||||||||| |
|
|
T |
23702020 |
ttggttgtatctctagatccttgtccggctggttgcggatgaagaatgtgtgttttttcatgttctttgt |
23701951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 209
Target Start/End: Complemental strand, 3790793 - 3790724
Alignment:
Q |
140 |
ttggttgtatctcaagatccctgtccggttggctgtggctgaaaaatgtgtgttttttcatgttctttgt |
209 |
Q |
|
|
|||||||||||||||||||| || ||||||| ||| ||||| | ||||||||||| ||||||||| |||| |
|
|
T |
3790793 |
ttggttgtatctcaagatccttgcccggttgactgcggctgtagaatgtgtgtttgttcatgttcattgt |
3790724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 209
Target Start/End: Complemental strand, 3828568 - 3828499
Alignment:
Q |
140 |
ttggttgtatctcaagatccctgtccggttggctgtggctgaaaaatgtgtgttttttcatgttctttgt |
209 |
Q |
|
|
|||||| ||||||||||||| || ||||||| ||| ||||| | ||||||||||| ||||||||| |||| |
|
|
T |
3828568 |
ttggttatatctcaagatccttgcccggttgactgcggctgtagaatgtgtgtttgttcatgttcattgt |
3828499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University