View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_high_23 (Length: 251)
Name: NF0671_high_23
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_high_23 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 53 - 251
Target Start/End: Original strand, 13615656 - 13615854
Alignment:
| Q |
53 |
gcaagatcaaaataaaatagtaatttagaggaggcttttgaaaaattggaatgcatttcgaagaggtgtgaaaatttagagatgcaaaggcaaaagtaag |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
13615656 |
gcaagatcaaaataaaatagtaatttagaggaggcttttgaaaaattgcaatgcatttcgaagaggtgtgaaaatttagtgatgtaaaggcaaaagtaag |
13615755 |
T |
|
| Q |
153 |
tgatcacaataaatatccccttaatttatggatgaaacaacctggnnnnnnnntatttgtttagttgtttgaaatggaaaaacttgtattacattaacc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13615756 |
tgatcacaataaatatccccttaatttatggatgaaacaacctggtaaaaaaaaaattgtttagttgtttgaaatggaaaaaattgtattacattaacc |
13615854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 53 - 197
Target Start/End: Original strand, 26302119 - 26302263
Alignment:
| Q |
53 |
gcaagatcaaaataaaatagtaatttagaggaggcttttgaaaaattggaatgcatttcgaagaggtgtgaaaatttagagatgcaaaggcaaaagtaag |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26302119 |
gcaagatcaaaataaaatagtaatttagaggaggcttttgaaaaattggaatgcatttcgaagaggtgtgaaaatttagagatgcaaaggcaaaagtaag |
26302218 |
T |
|
| Q |
153 |
tgatcacaataaatatccccttaatttatggatgaaacaacctgg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26302219 |
tgatcacaataaatatccccttaatttatggatgaaacaacctgg |
26302263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 217 - 251
Target Start/End: Original strand, 26302274 - 26302308
Alignment:
| Q |
217 |
ttgtttgaaatggaaaaacttgtattacattaacc |
251 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
26302274 |
ttgtttgaaatggaaaaaattgtattacattaacc |
26302308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 40
Target Start/End: Original strand, 26302076 - 26302108
Alignment:
| Q |
8 |
ccaataatatgagaatgagaataagataaataa |
40 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
26302076 |
ccaacaatatgagaatgagaataagataaataa |
26302108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2712 times since January 2019
Visitors: 4011