View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_high_24 (Length: 250)
Name: NF0671_high_24
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0671_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 12 - 117
Target Start/End: Complemental strand, 3095439 - 3095334
Alignment:
Q |
12 |
aaatagagggagtatatcatttccataccgaaaatattgattaacaaaattaatttttcatgccacgaatctacagtcacttaatctaagttcgattaaa |
111 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
3095439 |
aaatagaggaagtatatcatttccataccgaaaatattgattaacaaaattaatttttcatgccacgaatctacagttacttaatctaagttcgattaaa |
3095340 |
T |
 |
Q |
112 |
atcatt |
117 |
Q |
|
|
|||||| |
|
|
T |
3095339 |
atcatt |
3095334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University