View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_high_27 (Length: 208)
Name: NF0671_high_27
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0671_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 38713608 - 38713719
Alignment:
Q |
1 |
aagattggagacttgacaaaaactatgcatgatgatttatggtgtttataacatgatatatacttttccttnnnnnnnnntgatatatagtttttaaagt |
100 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
38713608 |
aagattggagacttgacaaaaaatatgcatgatgatttatggtgtttataacatgatatatacttttccttaaaaaaaaatgatatatagtttttaaagt |
38713707 |
T |
 |
Q |
101 |
tataactttttg |
112 |
Q |
|
|
|||||||||||| |
|
|
T |
38713708 |
tataactttttg |
38713719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3034 times since January 2019
Visitors: 4024