View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0671_low_10 (Length: 466)

Name: NF0671_low_10
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0671_low_10
NF0671_low_10
[»] chr1 (3 HSPs)
chr1 (387-437)||(31867936-31867987)
chr1 (243-277)||(31867824-31867858)
chr1 (325-368)||(31858753-31858796)


Alignment Details
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 387 - 437
Target Start/End: Original strand, 31867936 - 31867987
Alignment:
387 aatgaatta-caggaaagtaactatatgagtttcatacaattgggaagagta 437  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||||||    
31867936 aatgaattaacaggaaagtaactatatgagtttgatacaattgggaagagta 31867987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 243 - 277
Target Start/End: Original strand, 31867824 - 31867858
Alignment:
243 tttgtttgtttgtgaaagagctctgttaatgggca 277  Q
    |||||||||||||||||||||||||||||||||||    
31867824 tttgtttgtttgtgaaagagctctgttaatgggca 31867858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 325 - 368
Target Start/End: Original strand, 31858753 - 31858796
Alignment:
325 tataactgaaatcaggtacttgaatgtcgatgatataatgaatt 368  Q
    ||||| ||||||||||||||||||||||| | ||||||||||||    
31858753 tataattgaaatcaggtacttgaatgtcgtttatataatgaatt 31858796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University