View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_10 (Length: 466)
Name: NF0671_low_10
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 387 - 437
Target Start/End: Original strand, 31867936 - 31867987
Alignment:
| Q |
387 |
aatgaatta-caggaaagtaactatatgagtttcatacaattgggaagagta |
437 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31867936 |
aatgaattaacaggaaagtaactatatgagtttgatacaattgggaagagta |
31867987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 243 - 277
Target Start/End: Original strand, 31867824 - 31867858
Alignment:
| Q |
243 |
tttgtttgtttgtgaaagagctctgttaatgggca |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31867824 |
tttgtttgtttgtgaaagagctctgttaatgggca |
31867858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 325 - 368
Target Start/End: Original strand, 31858753 - 31858796
Alignment:
| Q |
325 |
tataactgaaatcaggtacttgaatgtcgatgatataatgaatt |
368 |
Q |
| |
|
||||| ||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
31858753 |
tataattgaaatcaggtacttgaatgtcgtttatataatgaatt |
31858796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2776 times since January 2019
Visitors: 4012