View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_13 (Length: 405)
Name: NF0671_low_13
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 23 - 335
Target Start/End: Original strand, 33676069 - 33676381
Alignment:
| Q |
23 |
atcatcatgtttttggtaactctatctatcatttttctaattacactattattagtaatagttgaatctggcttattaattgaattttgtctgtgccagc |
122 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33676069 |
atcattatgtttttggtaactctatctatcatttttctaattacactattattagtaatagttgaatctggcttattaattgaattttgtctgtgccagc |
33676168 |
T |
|
| Q |
123 |
caaaatttaatgacaatctgttgactgcggagttcgtccatggaaatgctgatcaacccaaggaaatgttcaactatgatgctcagttaccgtctattgg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33676169 |
caaaatttaatgacaatctgttgactgcggagttcgtccatgggaatgctgatcaacccaaggaaatgttcaactatgatgctcagttaccgcctattgg |
33676268 |
T |
|
| Q |
223 |
aagagggaatgtgccgaaacaaaatgatcaatttaagcagtacttccccccatccaagtctgtcatgttaaacaacaaatctgatttaatccagatccgt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33676269 |
aagagggaatgtgccgaaacaaaatgatcaatttaagcagtacttccccccatccaagtctgtcatgttaaacaacaaatctgatttaatccagatccgt |
33676368 |
T |
|
| Q |
323 |
gcaacagctaggg |
335 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
33676369 |
gcaacagataggg |
33676381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2950 times since January 2019
Visitors: 4020