View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_19 (Length: 347)
Name: NF0671_low_19
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 7e-77; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 15 - 172
Target Start/End: Complemental strand, 9988066 - 9987909
Alignment:
| Q |
15 |
agatagacacataaagtgaagtcgattattcaaattcgataatattgtaggaaaatagcgggataaacttccttgttaggggctctctcgtaaatgaatg |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9988066 |
agataaacacataaagtgaagtcgattattcaaattcgataatattgtaggaaaatagcgggataaacttccttgttaagggctctctcgtaaatgaatg |
9987967 |
T |
|
| Q |
115 |
taaacaaaccagttctcattttaatcatgttgtttttgctcatattagatgagaagtt |
172 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9987966 |
taaactaaccagttctcattttaatcatgttgtttttgctcatattagatgagaagtt |
9987909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 143 - 212
Target Start/End: Complemental strand, 9987911 - 9987842
Alignment:
| Q |
143 |
gttgtttttgctcatattagatgagaagttaatcaaacggctcattatttagctaagtttgcaattgata |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9987911 |
gttgtttttgctcagattagatgagaagttaatcaaacggctcattatttagctaagtttgcaattgata |
9987842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 212 - 261
Target Start/End: Complemental strand, 9987816 - 9987767
Alignment:
| Q |
212 |
agaaactccttcttgtattgacacggttgtggcttttgagatgatgtcca |
261 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
9987816 |
agaaactcctccttatattgacacggttgtggcttttgatatgatgtcca |
9987767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 20781967 - 20782021
Alignment:
| Q |
153 |
ctcatattagatgagaagttaatcaaacggctcattatttagctaagtttgcaat |
207 |
Q |
| |
|
||||| ||||| |||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
20781967 |
ctcatgttagaagagaagctaatcaagctgctcattatttagctaagtttgcaat |
20782021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2756 times since January 2019
Visitors: 4012