View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_20 (Length: 316)
Name: NF0671_low_20
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0671_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 71 - 241
Target Start/End: Original strand, 43567950 - 43568120
Alignment:
Q |
71 |
gtaaactcatgagtttttccgtctatctcaatgagactatatccaggttgttttctaacccctttttccttcattaatcttctcatgacagtagcatctt |
170 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43567950 |
gtaaactcatgagtttttccgtctatctcaatgagactatatccaggttgttttctaacccctttttccttcattaatcttctcatgacagtagcatctt |
43568049 |
T |
 |
Q |
171 |
tccacttgtttgtacgcgcatatatgttcgacagcaacacataataaccactatgttctggtttcatctca |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
43568050 |
tccacttgtttgtacgcgcatatatgttcgacagcaacgcataataaccactatgttctggtttcatctca |
43568120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2928 times since January 2019
Visitors: 4019