View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0671_low_21 (Length: 315)

Name: NF0671_low_21
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0671_low_21
NF0671_low_21
[»] chr7 (1 HSPs)
chr7 (1-218)||(43567691-43567908)
[»] chr1 (1 HSPs)
chr1 (172-208)||(2447183-2447219)


Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 43567908 - 43567691
Alignment:
1 gaatgtgggaaaaaatactgcaaaaaataaagttagcagggtacatgggaaatactagtgaggcattgtttgacatagatgaggaggaaaaagaagatgc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43567908 gaatgtgggaaaaaatactgcaaaaaataaagttagcagggtacatgggaaatactagtgaggcattgtttgacatagatgaggaggaaaaagaagatgc 43567809  T
101 acttcacaggcatggtgagaaactggccatttcctatggaattatgaagattcaagctcctgggcctattcggattgtgaaaaacttgcgtgtctgtgaa 200  Q
    ||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
43567808 acttcacaggcatagtgagaaactggccattgcctatggaattatgaagattcaagctcctgggactattcggattgtgaaaaacttgcgtgtctgtgaa 43567709  T
201 gattgtcacacagctacc 218  Q
    ||||||||||||||||||    
43567708 gattgtcacacagctacc 43567691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 172 - 208
Target Start/End: Original strand, 2447183 - 2447219
Alignment:
172 ggattgtgaaaaacttgcgtgtctgtgaagattgtca 208  Q
    |||||||||| |||||||||||||| |||||||||||    
2447183 ggattgtgaagaacttgcgtgtctgcgaagattgtca 2447219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3086 times since January 2019
Visitors: 4027