View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0671_low_22 (Length: 315)

Name: NF0671_low_22
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0671_low_22
NF0671_low_22
[»] chr8 (1 HSPs)
chr8 (78-315)||(7385731-7385968)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 78 - 315
Target Start/End: Original strand, 7385731 - 7385968
Alignment:
78 atatataagtaagaagtctcataaactctaaagtatttagattttaggtaaagatgttgtgtccaactcacttgtataccgttactcttggcgaaatgtg 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
7385731 atatataagtaagaagtctcataaactctaaagtatttagattttaggtaaagatgttgtatccaaatcacttgtataccgttactcttggcgaaatgtg 7385830  T
178 gatgatcctctaggttaccgttgtgatccaacagtggtataagaaccgatggttcaacttgcgtttaatcgactctttgtgtcgaaagtctttctaacaa 277  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||    
7385831 gatgatcccctaggttaccgttgtgatccaacagtggtataagaaccgatggttcaacttgcgttcaatcgactctttgtgtcgaaagtctttttaacaa 7385930  T
278 tgatggtcagggagacgtattccgttgacgcaacaaca 315  Q
    ||||||| ||||||||||||| ||||||||||||||||    
7385931 tgatggttagggagacgtatttcgttgacgcaacaaca 7385968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University