View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_26 (Length: 280)
Name: NF0671_low_26
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 23 - 222
Target Start/End: Original strand, 3095784 - 3095966
Alignment:
| Q |
23 |
taataataaactcatgaactcgtcatcaccaacatgtattctgggcaaagagacctttaatcgtttaagccgataatttcacaagtcaattgtgagataa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3095784 |
taataataaactcatgaactcgtcatcaccaacatgtattctgggcaaagagacctttaatcgtttaagccgatgatttcacaagtcaattgtgagataa |
3095883 |
T |
 |
| Q |
123 |
tttctaattataatactccctcttctggtattaattctccactcctattaattttccacttcttttcttttaatcggttaaggtgaagatggatttcaca |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3095884 |
tttctagttataatactccctcttctggtattaattc-----------------tccacttcttttcttttaatcggttaaggtgaagatggatttcaca |
3095966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University