View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_28 (Length: 274)
Name: NF0671_low_28
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 16 - 271
Target Start/End: Original strand, 28330027 - 28330282
Alignment:
| Q |
16 |
atcaaccccactgtttatacttatagtgcactaatggcttatctatgcaaaaggaagagggtaagagaatctaaagcattgcttaacacaatgatcaaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28330027 |
atcaaccccactgtttatacttatagtgcactaatggcttatctatgcaaaaggaagagggtaagagaatctaaagcattgcttaacacaatgatcaaag |
28330126 |
T |
|
| Q |
116 |
atggacttgagcctgatcttgctatttttaacacgctaatggaagggcattgctcacttcatcaaatgcaaaaggctaaaagaatattctactcattgcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28330127 |
atggacttgagcctgatcttgctatttttaacacgctaatggaagggcattgctcacttcatcaaatgcaaaaggctaaaagaatattctactcattgcc |
28330226 |
T |
|
| Q |
216 |
tcaaagaggaattactccggacatatacagctacaatattcttttcaaaggacttt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28330227 |
tcaaagaggaattactccggacatatacagctacaatattcttttcaaaggacttt |
28330282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2913 times since January 2019
Visitors: 4018