View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_29 (Length: 274)
Name: NF0671_low_29
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0671_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 47 - 243
Target Start/End: Original strand, 4497928 - 4498123
Alignment:
Q |
47 |
tcatcatttaaatacaatttgtcttccaatcggtcaatggctgatagttttatccttggtttttaaatgaaatgagtctggcaacaccattggatgtgtt |
146 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4497928 |
tcatcatttaaatacaatt-gtcttccaatcggtcaatggctgatagttttatccttggtttttaaatgaaatgagtctggcaacaccattggatgtgtt |
4498026 |
T |
 |
Q |
147 |
actcaataaccaattacttaggcactttgacaagggattatttaactgcccctataatcggttatttttctgctgtgttgttccaaatgtctgtgct |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4498027 |
actcaataaccaattacttaggcactttgacaagggattatttaactgcccctataatcggttatttttctgctgtgttgttccaaatgtctgtgct |
4498123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2718 times since January 2019
Visitors: 4011